| BP914635 | |
| Clone id | YMU001_000061_C01 |
| Library | YMU01 |
| Length | 433 |
| Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000061_C01. |
| Accession | BP914635 |
| Tissue type | prothallium |
| Developmental stage | - |
| Contig ID | - |
| Sequence | AGCAGGTTTTGTGTTAGTCTTGTGCACTTCTCTTTCATTATTAGCGAGTGCTACCTAAAG |
| ■■Homology search results ■■ | - |
| Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
| sp_hit_id | Q149F1 |
| Definition | sp|Q149F1|RUSD2_MOUSE RNA pseudouridylate synthase domain-containing protein 2 OS=Mus musculus |
| Align length | 33 |
| Score (bit) | 30.8 |
| E-value | 2.5 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
| TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
| tr_hit_id | - |
| Definition | No hits. |
| Align length | - |
| Score (bit) | - |
| E-value | - |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |