BP915051 | |
Clone id | YMU001_000065_H09 |
Library | YMU01 |
Length | 339 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000065_H09. |
Accession | BP915051 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | CL7Contig6 |
Sequence | AAATATGGGGGCTCATCAGCAACCTCCCCGAGGTCGACTTCGTCGTCGTCGATGGCGGGG |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | - |
Definition | No hits. |
Align length | - |
Score (bit) | - |
E-value | - |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | A9NY76 |
Definition | tr|A9NY76|A9NY76_PICSI Putative uncharacterized protein OS=Picea sitchensis |
Align length | 35 |
Score (bit) | 52.0 |
E-value | 1.0e-05 |
Report | BLASTX 2.2.19 [Nov-02-2008] |