BP915088 |
Clone id |
YMU001_000066_D03 |
Library |
YMU01 |
Length |
128 |
Definition |
Adiantum capillus-veneris mRNA. clone: YMU001_000066_D03. |
Accession |
BP915088 |
Tissue type |
prothallium |
Developmental stage |
- |
Contig ID |
CL1521Contig1 |
Sequence |
ATCAAGCTGTTCACACAAATCTCTGGCTGGCTGTTCTTCCATTCCTATGACCATGTTCTC TTGCAAATCATCTGAATTTACTTTATCACATGTCTCTTTACTCTGGACTGAGACTTGATC ATCATTGG |
■■Homology search results ■■ |
- |
Swiss-Prot (release 56.9) |
Link to BlastX Result : Swiss-Prot |
sp_hit_id |
Q0VAV2 |
Definition |
sp|Q0VAV2|EXPH5_MOUSE Exophilin-5 OS=Mus musculus |
Align length |
29 |
Score (bit) |
28.9 |
E-value |
8.3 |
Report |
|
TrEMBL (release 39.9) |
Link to BlastX Result : TrEMBL |
tr_hit_id |
- |
Definition |
No hits. |
Align length |
- |
Score (bit) |
- |
E-value |
- |
Report |
|