| BP915088 |
| Clone id |
YMU001_000066_D03 |
| Library |
YMU01 |
| Length |
128 |
| Definition |
Adiantum capillus-veneris mRNA. clone: YMU001_000066_D03. |
| Accession |
BP915088 |
| Tissue type |
prothallium |
| Developmental stage |
- |
| Contig ID |
CL1521Contig1 |
| Sequence |
ATCAAGCTGTTCACACAAATCTCTGGCTGGCTGTTCTTCCATTCCTATGACCATGTTCTC TTGCAAATCATCTGAATTTACTTTATCACATGTCTCTTTACTCTGGACTGAGACTTGATC ATCATTGG |
| ■■Homology search results ■■ |
- |
| Swiss-Prot (release 56.9) |
Link to BlastX Result : Swiss-Prot |
| sp_hit_id |
Q0VAV2 |
| Definition |
sp|Q0VAV2|EXPH5_MOUSE Exophilin-5 OS=Mus musculus |
| Align length |
29 |
| Score (bit) |
28.9 |
| E-value |
8.3 |
| Report |
 |
| TrEMBL (release 39.9) |
Link to BlastX Result : TrEMBL |
| tr_hit_id |
- |
| Definition |
No hits. |
| Align length |
- |
| Score (bit) |
- |
| E-value |
- |
| Report |
 |