BP915161 | |
Clone id | YMU001_000067_C03 |
Library | YMU01 |
Length | 341 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000067_C03. |
Accession | BP915161 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | CL1314Contig1 |
Sequence | ATCAACTTAAGAACAATCGTGCATCGCTTATAGGTATTGTTTTTGTATACATTAATCAAA |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | O08590 |
Definition | sp|O08590|AOC3_RAT Membrane primary amine oxidase OS=Rattus norvegicus |
Align length | 40 |
Score (bit) | 29.6 |
E-value | 4.9 |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | A9RNN2 |
Definition | tr|A9RNN2|A9RNN2_PHYPA Predicted protein OS=Physcomitrella patens subsp. patens |
Align length | 47 |
Score (bit) | 69.3 |
E-value | 9.0e-11 |
Report | BLASTX 2.2.19 [Nov-02-2008] |