BP915424 | |
Clone id | YMU001_000071_D07 |
Library | YMU01 |
Length | 241 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000071_D07. |
Accession | BP915424 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | CL4117Contig1 |
Sequence | GAGTAGTTATCTCCACAGCAGAAACAGTATGGCGATAGAAGGATTTGACAGCCCACAAAG |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | Q00174 |
Definition | sp|Q00174|LAMA_DROME Laminin subunit alpha OS=Drosophila melanogaster |
Align length | 55 |
Score (bit) | 30.0 |
E-value | 3.8 |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | A7PJC5 |
Definition | tr|A7PJC5|A7PJC5_VITVI Chromosome chr12 scaffold_18, whole genome shotgun sequence OS=Vitis vinifera |
Align length | 60 |
Score (bit) | 63.5 |
E-value | 5.0e-09 |
Report | BLASTX 2.2.19 [Nov-02-2008] |