| BP915424 | |
| Clone id | YMU001_000071_D07 |
| Library | YMU01 |
| Length | 241 |
| Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000071_D07. |
| Accession | BP915424 |
| Tissue type | prothallium |
| Developmental stage | - |
| Contig ID | CL4117Contig1 |
| Sequence | GAGTAGTTATCTCCACAGCAGAAACAGTATGGCGATAGAAGGATTTGACAGCCCACAAAG |
| ■■Homology search results ■■ | - |
| Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
| sp_hit_id | Q00174 |
| Definition | sp|Q00174|LAMA_DROME Laminin subunit alpha OS=Drosophila melanogaster |
| Align length | 55 |
| Score (bit) | 30.0 |
| E-value | 3.8 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
| TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
| tr_hit_id | A7PJC5 |
| Definition | tr|A7PJC5|A7PJC5_VITVI Chromosome chr12 scaffold_18, whole genome shotgun sequence OS=Vitis vinifera |
| Align length | 60 |
| Score (bit) | 63.5 |
| E-value | 5.0e-09 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |