BP915485
Clone id YMU001_000072_B11
Library
Length 526
Definition Adiantum capillus-veneris mRNA. clone: YMU001_000072_B11.
Accession
Tissue type prothallium
Developmental stage -
Contig ID
Sequence
ACCGCCCTTGGAATCCAACCAAAACAGGCGTGCAATGCAATTCGACTTGGAGGAGTCTTC
AAGTGATGAAGAGGATTGACAGTGATGAACAAGTTGCAAAGTCATGGAGCAGATTGGAGA
GAGAAGCTTTGCTTTGATTGCCAACACAACAGAAAACCAGTGGTTATCTTCATTTTGTAG
ACAGAGCCTCAGTTGGGAAATTCCAACGGCGGGAAAGGTAAGCGTCTGCAGATTTGTTTG
GCTCCATTATTATTCACCTGAAGGGGTCAGTGCAAAATTGCAGTGAGTACCCTTAGCCGC
CATTTTTGCTCTTGGTATATTGAATGGGTAAAGCACCTTCAACAAAGTTTCAAGCTTGAT
TTCCATAAGATGCTTTTGATTTGCCTTGCATAGATTCTGTTGTAGAGGATGGTTCGGTTA
TACAGGCCTTGGCAACAATTTTGTAACCATGCTAAATATTCCTCTTACGCAAGCTTCTGA
TACATGTATTTTTCTAACATTGTGTACCTTGCCTTAATGCAAAATG
■■Homology search results ■■ -
sp_hit_id P36345
Definition sp|P36345|VP40_NPVHZ Structural glycoprotein p40 OS=Heliothis zea nuclear polyhedrosis virus
Align length 24
Score (bit) 30.4
E-value 5.3
Report
BLASTX 2.2.19 [Nov-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.

Query= BP915485|Adiantum capillus-veneris mRNA, clone:
YMU001_000072_B11.
(526 letters)

Database: uniprot_sprot.fasta
412,525 sequences; 148,809,765 total letters

Searching..................................................done



Score E
Sequences producing significant alignments: (bits) Value

sp|P36345|VP40_NPVHZ Structural glycoprotein p40 OS=Heliothis ze... 30 5.3

>sp|P36345|VP40_NPVHZ Structural glycoprotein p40 OS=Heliothis zea
nuclear polyhedrosis virus GN=P40 PE=2 SV=1
Length = 322

Score = 30.4 bits (67), Expect = 5.3
Identities = 13/24 (54%), Positives = 18/24 (75%)
Frame = +3

Query: 54 SLQVMKRIDSDEQVAKSWSRLERE 125
S+ V+KR DSDE + K +SRL +E
Sbjct: 73 SVNVVKRFDSDENLIKHYSRLRKE 96


tr_hit_id A2F0B4
Definition tr|A2F0B4|A2F0B4_TRIVA Putative uncharacterized protein OS=Trichomonas vaginalis G3
Align length 83
Score (bit) 34.7
E-value 3.0
Report
BLASTX 2.2.19 [Nov-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.

Query= BP915485|Adiantum capillus-veneris mRNA, clone:
YMU001_000072_B11.
(526 letters)

Database: uniprot_trembl.fasta
7,341,751 sequences; 2,391,615,440 total letters

Searching..................................................done



Score E
Sequences producing significant alignments: (bits) Value

tr|A2F0B4|A2F0B4_TRIVA Putative uncharacterized protein OS=Trich... 35 3.0
tr|Q0V0T8|Q0V0T8_PHANO Putative uncharacterized protein OS=Phaeo... 33 8.8

>tr|A2F0B4|A2F0B4_TRIVA Putative uncharacterized protein
OS=Trichomonas vaginalis G3 GN=TVAG_384150 PE=4 SV=1
Length = 846

Score = 34.7 bits (78), Expect = 3.0
Identities = 27/83 (32%), Positives = 37/83 (44%), Gaps = 10/83 (12%)
Frame = +2

Query: 224 VCRFVWLHY-------YSPEGVSAKLQ*VPLAAIFALGILNG*STFNKVSSLISIRCF*F 382
+C +WL+ Y EG+ K+ +AA+FA FN V+ L+ I F F
Sbjct: 405 ICIIIWLYRAVVTVKRYGTEGIDFKV----IAALFA-------EAFNIVAWLLFIMAFVF 453

Query: 383 ALHRFCCRGW---FGYTGLGNNF 442
+ FC W YT LGN F
Sbjct: 454 SFAIFCAYKWTPSSKYTILGNEF 476


>tr|Q0V0T8|Q0V0T8_PHANO Putative uncharacterized protein
OS=Phaeosphaeria nodorum GN=SNOG_02376 PE=4 SV=2
Length = 505

Score = 33.1 bits (74), Expect = 8.8
Identities = 16/38 (42%), Positives = 24/38 (63%)
Frame = -2

Query: 468 VRGIFSMVTKLLPRPV*PNHPLQQNLCKANQKHLMEIK 355
++G S+V K+ R P PLQQN+ A QKH+ ++K
Sbjct: 15 IKGPASLVGKIKARAAKPPVPLQQNIPAAVQKHIAQLK 52