| BP915505 | |
| Clone id | YMU001_000072_D09 |
| Library | YMU01 |
| Length | 554 |
| Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000072_D09. |
| Accession | BP915505 |
| Tissue type | prothallium |
| Developmental stage | - |
| Contig ID | - |
| Sequence | AGTGTCAATTGCTCTCAAGCAAGAATTGGGACGGAGGGGAACATGCTGTATGGACAGGGC |
| ■■Homology search results ■■ | - |
| Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
| sp_hit_id | Q9GK77 |
| Definition | sp|Q9GK77|UPAR_AOTTR Urokinase plasminogen activator surface receptor OS=Aotus trivirgatus |
| Align length | 45 |
| Score (bit) | 30.0 |
| E-value | 7.9 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
| TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
| tr_hit_id | B6M6Z7 |
| Definition | tr|B6M6Z7|B6M6Z7_BRAFL Putative uncharacterized protein OS=Branchiostoma floridae |
| Align length | 58 |
| Score (bit) | 34.3 |
| E-value | 4.6 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |