BP915505 | |
Clone id | YMU001_000072_D09 |
Library | YMU01 |
Length | 554 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000072_D09. |
Accession | BP915505 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | - |
Sequence | AGTGTCAATTGCTCTCAAGCAAGAATTGGGACGGAGGGGAACATGCTGTATGGACAGGGC |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | Q9GK77 |
Definition | sp|Q9GK77|UPAR_AOTTR Urokinase plasminogen activator surface receptor OS=Aotus trivirgatus |
Align length | 45 |
Score (bit) | 30.0 |
E-value | 7.9 |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | B6M6Z7 |
Definition | tr|B6M6Z7|B6M6Z7_BRAFL Putative uncharacterized protein OS=Branchiostoma floridae |
Align length | 58 |
Score (bit) | 34.3 |
E-value | 4.6 |
Report | BLASTX 2.2.19 [Nov-02-2008] |