BP915645 | |
Clone id | YMU001_000074_A09 |
Library | YMU01 |
Length | 528 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000074_A09. |
Accession | BP915645 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | - |
Sequence | TTGTTGCTCAAATGGAAGATCCTAATTAGACATTTTTGTCAAAGTGTGATCTGTGCTATC |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | - |
Definition | No hits. |
Align length | - |
Score (bit) | - |
E-value | - |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | B6UGE0 |
Definition | tr|B6UGE0|B6UGE0_MAIZE Putative uncharacterized protein OS=Zea mays |
Align length | 34 |
Score (bit) | 50.1 |
E-value | 7.0e-05 |
Report | BLASTX 2.2.19 [Nov-02-2008] |