| BP915786 | |
| Clone id | YMU001_000076_G09 |
| Library | YMU01 |
| Length | 511 |
| Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000076_G09. |
| Accession | BP915786 |
| Tissue type | prothallium |
| Developmental stage | - |
| Contig ID | CL3951Contig1 |
| Sequence | CCCTAACAAGCCAATTAAAGAATCTTTCACATGAGGGTGTTGTTCTTGGTATTTCAAAGA |
| ■■Homology search results ■■ | - |
| Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
| sp_hit_id | Q75DS1 |
| Definition | sp|Q75DS1|RPA2_ASHGO DNA-directed RNA polymerase I subunit RPA2 OS=Ashbya gossypii |
| Align length | 41 |
| Score (bit) | 31.6 |
| E-value | 2.2 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
| TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
| tr_hit_id | A9RTW1 |
| Definition | tr|A9RTW1|A9RTW1_PHYPA Predicted protein OS=Physcomitrella patens subsp. patens |
| Align length | 80 |
| Score (bit) | 42.0 |
| E-value | 0.017 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |