| BP915961 | |
| Clone id | YMU001_000081_A12 |
| Library | YMU01 |
| Length | 440 |
| Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000081_A12. |
| Accession | BP915961 |
| Tissue type | prothallium |
| Developmental stage | - |
| Contig ID | CL3770Contig1 |
| Sequence | CTGTTGTAAAGTAAACTTCATTCCCCTCGGACTTGACCTTCTCTGCCGTCTTCGACACCA |
| ■■Homology search results ■■ | - |
| Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
| sp_hit_id | Q39FE7 |
| Definition | sp|Q39FE7|TIG_BURS3 Trigger factor OS=Burkholderia sp. (strain 383) |
| Align length | 40 |
| Score (bit) | 29.3 |
| E-value | 7.5 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
| TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
| tr_hit_id | A8SJ76 |
| Definition | tr|A8SJ76|A8SJ76_9GAMM Particulate methane monooxygenase subunit A (Fragment) OS=uncultured gamma proteobacterium |
| Align length | 56 |
| Score (bit) | 33.5 |
| E-value | 5.4 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |