BP915961 | |
Clone id | YMU001_000081_A12 |
Library | YMU01 |
Length | 440 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000081_A12. |
Accession | BP915961 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | CL3770Contig1 |
Sequence | CTGTTGTAAAGTAAACTTCATTCCCCTCGGACTTGACCTTCTCTGCCGTCTTCGACACCA |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | Q39FE7 |
Definition | sp|Q39FE7|TIG_BURS3 Trigger factor OS=Burkholderia sp. (strain 383) |
Align length | 40 |
Score (bit) | 29.3 |
E-value | 7.5 |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | A8SJ76 |
Definition | tr|A8SJ76|A8SJ76_9GAMM Particulate methane monooxygenase subunit A (Fragment) OS=uncultured gamma proteobacterium |
Align length | 56 |
Score (bit) | 33.5 |
E-value | 5.4 |
Report | BLASTX 2.2.19 [Nov-02-2008] |