| BP916094 | |
| Clone id | YMU001_000083_A08 |
| Library | YMU01 |
| Length | 402 |
| Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000083_A08. |
| Accession | BP916094 |
| Tissue type | prothallium |
| Developmental stage | - |
| Contig ID | CL2153Contig1 |
| Sequence | GCGTGCATAAGCACGATCTAAATAATTTTCCAGCTCTGTGTCATACTTCTGCCGCTCTAC |
| ■■Homology search results ■■ | - |
| Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
| sp_hit_id | P08750 |
| Definition | sp|P08750|DACA_BACSU D-alanyl-D-alanine carboxypeptidase dacA OS=Bacillus subtilis |
| Align length | 68 |
| Score (bit) | 30.8 |
| E-value | 2.2 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
| TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
| tr_hit_id | Q1EPL1 |
| Definition | tr|Q1EPL1|Q1EPL1_MUSAC FtsJ-like methyltransferase family protein OS=Musa acuminata |
| Align length | 135 |
| Score (bit) | 55.5 |
| E-value | 1.0e-06 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |