BP916139 | |
Clone id | YMU001_000083_F02 |
Library | YMU01 |
Length | 449 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000083_F02. |
Accession | BP916139 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | CL2906Contig1 |
Sequence | ATGTCTTTGAATGAATGAAAATACATTCAAACTGTGAACCTTTGCAGCTAAAAGGCACAG |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | A6WFJ3 |
Definition | sp|A6WFJ3|PURA_KINRD Adenylosuccinate synthetase OS=Kineococcus radiotolerans (strain ATCC BAA-149 / DSM 14245 / SRS30216) |
Align length | 24 |
Score (bit) | 30.0 |
E-value | 4.3 |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | A5G9N9 |
Definition | tr|A5G9N9|A5G9N9_GEOUR Sensor protein OS=Geobacter uraniireducens (strain Rf4) |
Align length | 39 |
Score (bit) | 35.0 |
E-value | 1.9 |
Report | BLASTX 2.2.19 [Nov-02-2008] |