| BP916143 | |
| Clone id | YMU001_000083_F07 |
| Library | YMU01 |
| Length | 496 |
| Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000083_F07. |
| Accession | BP916143 |
| Tissue type | prothallium |
| Developmental stage | - |
| Contig ID | - |
| Sequence | CAGACCACTAGAGAGCGAGGAAAAACAGCAGTCGTCGTTGGCTTTGGCAGAGCATGATGC |
| ■■Homology search results ■■ | - |
| Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
| sp_hit_id | Q6X784 |
| Definition | sp|Q6X784|ZPBP2_HUMAN Zona pellucida-binding protein 2 OS=Homo sapiens |
| Align length | 34 |
| Score (bit) | 29.6 |
| E-value | 7.9 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
| TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
| tr_hit_id | A0DP23 |
| Definition | tr|A0DP23|A0DP23_PARTE Chromosome undetermined scaffold_582, whole genome shotgun sequence OS=Paramecium tetraurelia |
| Align length | 72 |
| Score (bit) | 35.4 |
| E-value | 1.5 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |