BP916143 | |
Clone id | YMU001_000083_F07 |
Library | YMU01 |
Length | 496 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000083_F07. |
Accession | BP916143 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | - |
Sequence | CAGACCACTAGAGAGCGAGGAAAAACAGCAGTCGTCGTTGGCTTTGGCAGAGCATGATGC |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | Q6X784 |
Definition | sp|Q6X784|ZPBP2_HUMAN Zona pellucida-binding protein 2 OS=Homo sapiens |
Align length | 34 |
Score (bit) | 29.6 |
E-value | 7.9 |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | A0DP23 |
Definition | tr|A0DP23|A0DP23_PARTE Chromosome undetermined scaffold_582, whole genome shotgun sequence OS=Paramecium tetraurelia |
Align length | 72 |
Score (bit) | 35.4 |
E-value | 1.5 |
Report | BLASTX 2.2.19 [Nov-02-2008] |