BP916177 | |
Clone id | YMU001_000084_C01 |
Library | YMU01 |
Length | 435 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000084_C01. |
Accession | BP916177 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | - |
Sequence | TAATGAGGGTCCTATCGAGCTACCACCTTTCAAAGTCGCCTCTAAGGTAGCGGTGACTAA |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | Q9Z319 |
Definition | sp|Q9Z319|CORIN_MOUSE Atrial natriuretic peptide-converting enzyme OS=Mus musculus |
Align length | 46 |
Score (bit) | 31.6 |
E-value | 1.5 |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | - |
Definition | No hits. |
Align length | - |
Score (bit) | - |
E-value | - |
Report | BLASTX 2.2.19 [Nov-02-2008] |