| BP916193 | |
| Clone id | YMU001_000084_D05 |
| Library | YMU01 |
| Length | 432 |
| Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000084_D05. |
| Accession | BP916193 |
| Tissue type | prothallium |
| Developmental stage | - |
| Contig ID | CL2021Contig1 |
| Sequence | GTTAAAAGTGATGATGCAGTGGATGATGAGACTGAAGCCTCAGGTAAGAGAAGCCGACAA |
| ■■Homology search results ■■ | - |
| Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
| sp_hit_id | Q54ML4 |
| Definition | sp|Q54ML4|HEAT1_DICDI HEAT repeat-containing protein 1 homolog OS=Dictyostelium discoideum |
| Align length | 60 |
| Score (bit) | 32.0 |
| E-value | 0.99 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
| TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
| tr_hit_id | Q2YCH0 |
| Definition | tr|Q2YCH0|Q2YCH0_NITMU Lipopolysaccharide biosynthesis OS=Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849) |
| Align length | 47 |
| Score (bit) | 34.7 |
| E-value | 2.4 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |