BP916193 | |
Clone id | YMU001_000084_D05 |
Library | YMU01 |
Length | 432 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000084_D05. |
Accession | BP916193 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | CL2021Contig1 |
Sequence | GTTAAAAGTGATGATGCAGTGGATGATGAGACTGAAGCCTCAGGTAAGAGAAGCCGACAA |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | Q54ML4 |
Definition | sp|Q54ML4|HEAT1_DICDI HEAT repeat-containing protein 1 homolog OS=Dictyostelium discoideum |
Align length | 60 |
Score (bit) | 32.0 |
E-value | 0.99 |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | Q2YCH0 |
Definition | tr|Q2YCH0|Q2YCH0_NITMU Lipopolysaccharide biosynthesis OS=Nitrosospira multiformis (strain ATCC 25196 / NCIMB 11849) |
Align length | 47 |
Score (bit) | 34.7 |
E-value | 2.4 |
Report | BLASTX 2.2.19 [Nov-02-2008] |