BP916362 | |
Clone id | YMU001_000086_G12 |
Library | YMU01 |
Length | 309 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000086_G12. |
Accession | BP916362 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | - |
Sequence | ACACCCGTAGTGGGTTTTGGATCATTGCTCTCCGCCTGGTCTCCACTGAGCCAGAGCGTC |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | Q5KFQ8 |
Definition | sp|Q5KFQ8|HSE1_CRYNE Class E vacuolar protein-sorting machinery protein HSE1 OS=Cryptococcus neoformans |
Align length | 86 |
Score (bit) | 29.6 |
E-value | 4.8 |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | B2ATJ2 |
Definition | tr|B2ATJ2|B2ATJ2_PODAN Predicted CDS Pa_1_16050 OS=Podospora anserina |
Align length | 62 |
Score (bit) | 35.0 |
E-value | 1.9 |
Report | BLASTX 2.2.19 [Nov-02-2008] |