| BP916362 | |
| Clone id | YMU001_000086_G12 |
| Library | YMU01 |
| Length | 309 |
| Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000086_G12. |
| Accession | BP916362 |
| Tissue type | prothallium |
| Developmental stage | - |
| Contig ID | - |
| Sequence | ACACCCGTAGTGGGTTTTGGATCATTGCTCTCCGCCTGGTCTCCACTGAGCCAGAGCGTC |
| ■■Homology search results ■■ | - |
| Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
| sp_hit_id | Q5KFQ8 |
| Definition | sp|Q5KFQ8|HSE1_CRYNE Class E vacuolar protein-sorting machinery protein HSE1 OS=Cryptococcus neoformans |
| Align length | 86 |
| Score (bit) | 29.6 |
| E-value | 4.8 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
| TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
| tr_hit_id | B2ATJ2 |
| Definition | tr|B2ATJ2|B2ATJ2_PODAN Predicted CDS Pa_1_16050 OS=Podospora anserina |
| Align length | 62 |
| Score (bit) | 35.0 |
| E-value | 1.9 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |