BP916392
Clone id YMU001_000087_B11
Library
Length 144
Definition Adiantum capillus-veneris mRNA. clone: YMU001_000087_B11.
Accession
Tissue type prothallium
Developmental stage -
Contig ID -
Sequence
TTGCTTAAAGTCCTCAACCCATATTATTACATTATTCACCAAGAACAGCAGCATACTACT
ACGTTCATGAAGTCTTCAATTGCTCTACTTTGTAATCAGGACTGAACAGCTGCATGACTT
GTCCAGACTAAATTTTTAGGGGAC
■■Homology search results ■■ -
sp_hit_id P54645
Definition sp|P54645|AAPK1_RAT 5'-AMP-activated protein kinase catalytic subunit alpha-1 OS=Rattus norvegicus
Align length 27
Score (bit) 28.9
E-value 8.2
Report
BLASTX 2.2.19 [Nov-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.

Query= BP916392|Adiantum capillus-veneris mRNA, clone:
YMU001_000087_B11.
(144 letters)

Database: uniprot_sprot.fasta
412,525 sequences; 148,809,765 total letters

Searching..................................................done



Score E
Sequences producing significant alignments: (bits) Value

sp|P54645|AAPK1_RAT 5'-AMP-activated protein kinase catalytic su... 29 8.2
sp|Q5EG47|AAPK1_MOUSE 5'-AMP-activated protein kinase catalytic ... 29 8.2

>sp|P54645|AAPK1_RAT 5'-AMP-activated protein kinase catalytic
subunit alpha-1 OS=Rattus norvegicus GN=Prkaa1 PE=1 SV=1
Length = 548

Score = 28.9 bits (63), Expect = 8.2
Identities = 12/27 (44%), Positives = 18/27 (66%)
Frame = +1

Query: 7 KVLNPYYYIIHQEQQHTTTFMKSSIAL 87
KV+NPYY + ++ T+TF K S+ L
Sbjct: 425 KVVNPYYLRVRRKNPVTSTFSKMSLQL 451


>sp|Q5EG47|AAPK1_MOUSE 5'-AMP-activated protein kinase catalytic
subunit alpha-1 OS=Mus musculus GN=Prkaa1 PE=1 SV=1
Length = 548

Score = 28.9 bits (63), Expect = 8.2
Identities = 12/27 (44%), Positives = 18/27 (66%)
Frame = +1

Query: 7 KVLNPYYYIIHQEQQHTTTFMKSSIAL 87
KV+NPYY + ++ T+TF K S+ L
Sbjct: 425 KVVNPYYLRVRRKNPVTSTFSKMSLQL 451


tr_hit_id -
Definition No hits.
Align length -
Score (bit) -
E-value -
Report
BLASTX 2.2.19 [Nov-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.

Query= BP916392|Adiantum capillus-veneris mRNA, clone:
YMU001_000087_B11.
(144 letters)

Database: uniprot_trembl.fasta
7,341,751 sequences; 2,391,615,440 total letters

Searching..................................................done

***** No hits found ******