BP916465 | |
Clone id | YMU001_000088_A04 |
Library | YMU01 |
Length | 384 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000088_A04. |
Accession | BP916465 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | - |
Sequence | GATGATAGTAATAGTCAGAGCGGCTTCTGGTTAGCATTATGCAAGGCTCTGACAAGGTTG |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | A5IDR5 |
Definition | sp|A5IDR5|KUP2_LEGPC Probable potassium transport system protein kup 2 OS=Legionella pneumophila (strain Corby) |
Align length | 40 |
Score (bit) | 38.1 |
E-value | 0.014 |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | - |
Definition | No hits. |
Align length | - |
Score (bit) | - |
E-value | - |
Report | BLASTX 2.2.19 [Nov-02-2008] |