BP916491 | |
Clone id | YMU001_000088_C06 |
Library | YMU01 |
Length | 448 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000088_C06. |
Accession | BP916491 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | - |
Sequence | TGAATATAGAGCAGGAGGAAGGCGAGGTTTCAGGGGAAGAGTTTGATGGCAAAAGACAAC |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | Q6EVK6 |
Definition | sp|Q6EVK6|BRM_ARATH ATP-dependent helicase BRM OS=Arabidopsis thaliana |
Align length | 69 |
Score (bit) | 54.3 |
E-value | 2.0e-07 |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | A7PZI5 |
Definition | tr|A7PZI5|A7PZI5_VITVI Chromosome chr15 scaffold_40, whole genome shotgun sequence OS=Vitis vinifera |
Align length | 69 |
Score (bit) | 50.8 |
E-value | 3.0e-05 |
Report | BLASTX 2.2.19 [Nov-02-2008] |