| BP916491 | |
| Clone id | YMU001_000088_C06 |
| Library | YMU01 |
| Length | 448 |
| Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000088_C06. |
| Accession | BP916491 |
| Tissue type | prothallium |
| Developmental stage | - |
| Contig ID | - |
| Sequence | TGAATATAGAGCAGGAGGAAGGCGAGGTTTCAGGGGAAGAGTTTGATGGCAAAAGACAAC |
| ■■Homology search results ■■ | - |
| Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
| sp_hit_id | Q6EVK6 |
| Definition | sp|Q6EVK6|BRM_ARATH ATP-dependent helicase BRM OS=Arabidopsis thaliana |
| Align length | 69 |
| Score (bit) | 54.3 |
| E-value | 2.0e-07 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
| TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
| tr_hit_id | A7PZI5 |
| Definition | tr|A7PZI5|A7PZI5_VITVI Chromosome chr15 scaffold_40, whole genome shotgun sequence OS=Vitis vinifera |
| Align length | 69 |
| Score (bit) | 50.8 |
| E-value | 3.0e-05 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |