BP916498
Clone id YMU001_000088_D02
Library
Length 499
Definition Adiantum capillus-veneris mRNA. clone: YMU001_000088_D02.
Accession
Tissue type prothallium
Developmental stage -
Contig ID
Sequence
CATCGTTAGTGTTGGGGAGCACAAACCCCAACGTTTGAGCATTTGGATGCAAGTATTGAG
CAAACAACAGTGTTTTATCGCGGAAACTGCATACACTCCAATGTTTCAGTGCTCTAGCGG
TTCCAGGCAAAAAACTCCAACATTTTTTGCCCCTAGCACTTTTCAGAAAAGAAACCTAGC
GTTTGTTTTTCCAGACCACTAAGCATTTGTACATGCTTGTGTTATTTCAGCAGTGGAAAG
GAAAATCTTCTGCATACAGCAGAGTTCCCTCTCCACCCCTATCCCCCTTATTGCCTCCGT
TTTACGTCAGGGTAATAACTTCTTGTGATTAGCTTCAGTTATTCAGACTCTTGATGTGTT
TTCAGCTTTGGGTTGAGTTTTCCAAGGTTTAGAGCTGAGGAACACAGGTCTCGTCTTTCC
TTGTACCCCCCTCCATTATCTCCTAGGCCCCAGTGCCTTTTGACAAGTATACCTCTATCT
ATCGACACTGTTTTGGATA
■■Homology search results ■■ -
sp_hit_id -
Definition No hits.
Align length -
Score (bit) -
E-value -
Report
BLASTX 2.2.19 [Nov-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.

Query= BP916498|Adiantum capillus-veneris mRNA, clone:
YMU001_000088_D02.
(499 letters)

Database: uniprot_sprot.fasta
412,525 sequences; 148,809,765 total letters

Searching..................................................done

***** No hits found ******


tr_hit_id B7BCD1
Definition tr|B7BCD1|B7BCD1_9PORP Putative uncharacterized protein (Fragment) OS=Parabacteroides johnsonii DSM 18315
Align length 51
Score (bit) 32.7
E-value 9.7
Report
BLASTX 2.2.19 [Nov-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.

Query= BP916498|Adiantum capillus-veneris mRNA, clone:
YMU001_000088_D02.
(499 letters)

Database: uniprot_trembl.fasta
7,341,751 sequences; 2,391,615,440 total letters

Searching..................................................done



Score E
Sequences producing significant alignments: (bits) Value

tr|B7BCD1|B7BCD1_9PORP Putative uncharacterized protein (Fragmen... 33 9.7
tr|A7AHP9|A7AHP9_9PORP Putative uncharacterized protein OS=Parab... 33 9.7

>tr|B7BCD1|B7BCD1_9PORP Putative uncharacterized protein (Fragment)
OS=Parabacteroides johnsonii DSM 18315
GN=PRABACTJOHN_02699 PE=4 SV=1
Length = 406

Score = 32.7 bits (73), Expect = 9.7
Identities = 20/51 (39%), Positives = 27/51 (52%)
Frame = -2

Query: 180 ARFLF*KVLGAKNVGVFCLEPLEH*NIGVYAVSAIKHCCLLNTCIQMLKRW 28
AR LF K GAK + +FCLEP+E + + V CC + LK+W
Sbjct: 71 ARLLFQKETGAK-IEIFCLEPVEPHDYAL--VFQQTECCRWTCLVGNLKKW 118


>tr|A7AHP9|A7AHP9_9PORP Putative uncharacterized protein
OS=Parabacteroides merdae ATCC 43184 GN=PARMER_02951
PE=4 SV=1
Length = 427

Score = 32.7 bits (73), Expect = 9.7
Identities = 20/51 (39%), Positives = 27/51 (52%)
Frame = -2

Query: 180 ARFLF*KVLGAKNVGVFCLEPLEH*NIGVYAVSAIKHCCLLNTCIQMLKRW 28
AR LF K GAK + +FCLEP+E + + V CC + LK+W
Sbjct: 92 ARLLFQKETGAK-IEIFCLEPVEPHDYAL--VFQQTECCRWTCLVGNLKKW 139