BP916750 | |
Clone id | YMU001_000091_B07 |
Library | YMU01 |
Length | 260 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000091_B07. |
Accession | BP916750 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | - |
Sequence | AACAGGGATAACATATCCAAGATAATTCTTCAACACAGCATATGAACATATCAAAAGGAA |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | P12287 |
Definition | sp|P12287|BLAR_BACLI Regulatory protein blaR1 OS=Bacillus licheniformis |
Align length | 79 |
Score (bit) | 29.3 |
E-value | 6.3 |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | A9RU81 |
Definition | tr|A9RU81|A9RU81_PHYPA Predicted protein OS=Physcomitrella patens subsp. patens |
Align length | 86 |
Score (bit) | 84.3 |
E-value | 3.0e-15 |
Report | BLASTX 2.2.19 [Nov-02-2008] |