BP916835 | |
Clone id | YMU001_000092_C08 |
Library | YMU01 |
Length | 146 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000092_C08. |
Accession | BP916835 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | - |
Sequence | ATTGGAGGTGGTCCACAGGCTCCTAGGTCAGCTCTTCCCATTGGTGCAGAACCAACAGCA |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | Q99LI9 |
Definition | sp|Q99LI9|CLP1_MOUSE Pre-mRNA cleavage complex II protein Clp1 OS=Mus musculus |
Align length | 42 |
Score (bit) | 35.8 |
E-value | 0.067 |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | A9RTM0 |
Definition | tr|A9RTM0|A9RTM0_PHYPA Predicted protein OS=Physcomitrella patens subsp. patens |
Align length | 48 |
Score (bit) | 84.3 |
E-value | 3.0e-15 |
Report | BLASTX 2.2.19 [Nov-02-2008] |