| BP916857 | |
| Clone id | YMU001_000092_F10 |
| Library | YMU01 |
| Length | 277 |
| Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000092_F10. |
| Accession | BP916857 |
| Tissue type | prothallium |
| Developmental stage | - |
| Contig ID | CL2039Contig1 |
| Sequence | GATGTGTCTCACAAGGAATGAGACGAAATACAAAGCATTAAAAGTCAATTAAAATTAAAC |
| ■■Homology search results ■■ | - |
| Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
| sp_hit_id | Q22811 |
| Definition | sp|Q22811|HM21_CAEEL Homeobox protein ceh-21 OS=Caenorhabditis elegans |
| Align length | 33 |
| Score (bit) | 29.3 |
| E-value | 6.4 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
| TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
| tr_hit_id | Q7XI89 |
| Definition | tr|Q7XI89|Q7XI89_ORYSJ Os07g0581300 protein OS=Oryza sativa subsp. japonica |
| Align length | 32 |
| Score (bit) | 47.4 |
| E-value | 0.0004 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |