| BP916880 | |
| Clone id | YMU001_000093_B06 |
| Library | YMU01 |
| Length | 515 |
| Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000093_B06. |
| Accession | BP916880 |
| Tissue type | prothallium |
| Developmental stage | - |
| Contig ID | - |
| Sequence | AGTTATTAACAATACACCAAACAAGTAGCAATGGAGAAGAATCACATCATTCCAGAGGTC |
| ■■Homology search results ■■ | - |
| Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
| sp_hit_id | Q989F1 |
| Definition | sp|Q989F1|Y6452_RHILO Maf-like protein mll6452 OS=Rhizobium loti |
| Align length | 47 |
| Score (bit) | 30.4 |
| E-value | 5.1 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
| TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
| tr_hit_id | B3L0E2 |
| Definition | tr|B3L0E2|B3L0E2_PLAKH Putative uncharacterized protein OS=Plasmodium knowlesi (strain H) |
| Align length | 45 |
| Score (bit) | 35.4 |
| E-value | 1.7 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |