BP916880 | |
Clone id | YMU001_000093_B06 |
Library | YMU01 |
Length | 515 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000093_B06. |
Accession | BP916880 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | - |
Sequence | AGTTATTAACAATACACCAAACAAGTAGCAATGGAGAAGAATCACATCATTCCAGAGGTC |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | Q989F1 |
Definition | sp|Q989F1|Y6452_RHILO Maf-like protein mll6452 OS=Rhizobium loti |
Align length | 47 |
Score (bit) | 30.4 |
E-value | 5.1 |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | B3L0E2 |
Definition | tr|B3L0E2|B3L0E2_PLAKH Putative uncharacterized protein OS=Plasmodium knowlesi (strain H) |
Align length | 45 |
Score (bit) | 35.4 |
E-value | 1.7 |
Report | BLASTX 2.2.19 [Nov-02-2008] |