| BP916938 | |
| Clone id | YMU001_000093_G08 |
| Library | YMU01 |
| Length | 425 |
| Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000093_G08. |
| Accession | BP916938 |
| Tissue type | prothallium |
| Developmental stage | - |
| Contig ID | - |
| Sequence | AACTGGAAGAATTCGCGGCCGCAGGAATGTGATTATTTGTTTTGCAAGAACAAACCCACG |
| ■■Homology search results ■■ | - |
| Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
| sp_hit_id | A8GPK1 |
| Definition | sp|A8GPK1|CLPX_RICAH ATP-dependent Clp protease ATP-binding subunit clpX OS=Rickettsia akari (strain Hartford) |
| Align length | 40 |
| Score (bit) | 29.6 |
| E-value | 4.9 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
| TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
| tr_hit_id | B0TY58 |
| Definition | tr|B0TY58|B0TY58_FRAP2 Putative uncharacterized protein OS=Francisella philomiragia subsp. philomiragia (strain ATCC 25017) |
| Align length | 47 |
| Score (bit) | 33.5 |
| E-value | 5.4 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |