BP916984 | |
Clone id | YMU001_000094_C11 |
Library | YMU01 |
Length | 520 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000094_C11. |
Accession | BP916984 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | CL2157Contig1 |
Sequence | CGAGTAGGCGAGGGCGAGGATGAAGCAGTGCATGTAAAAATACCATCTTTCGGGGCGTAG |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | - |
Definition | No hits. |
Align length | - |
Score (bit) | - |
E-value | - |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | A1C9F9 |
Definition | tr|A1C9F9|A1C9F9_ASPCL Amino acid permease OS=Aspergillus clavatus |
Align length | 53 |
Score (bit) | 35.4 |
E-value | 1.7 |
Report | BLASTX 2.2.19 [Nov-02-2008] |