BP917028 |
Clone id |
YMU001_000095_A02 |
Library |
YMU01 |
Length |
113 |
Definition |
Adiantum capillus-veneris mRNA. clone: YMU001_000095_A02. |
Accession |
BP917028 |
Tissue type |
prothallium |
Developmental stage |
- |
Contig ID |
- |
Sequence |
AATCCATCTACATCCTTTACCCTATAGACATAACATGTAGGTGCTTGAGTGTTGGAAAAA TATGGCACAAAGCTTTCCTGAATTTCATGGATTGCCACATGAAGATGCTAATG |
■■Homology search results ■■ |
- |
Swiss-Prot (release 56.9) |
Link to BlastX Result : Swiss-Prot |
sp_hit_id |
Q24400 |
Definition |
sp|Q24400|MLP2_DROME Muscle LIM protein Mlp84B OS=Drosophila melanogaster |
Align length |
18 |
Score (bit) |
30.0 |
E-value |
3.8 |
Report |
|
TrEMBL (release 39.9) |
Link to BlastX Result : TrEMBL |
tr_hit_id |
- |
Definition |
No hits. |
Align length |
- |
Score (bit) |
- |
E-value |
- |
Report |
|