BP917238
Clone id YMU001_000098_A12
Library
Length 288
Definition Adiantum capillus-veneris mRNA. clone: YMU001_000098_A12.
Accession
Tissue type prothallium
Developmental stage -
Contig ID -
Sequence
TCTGAACCAAGCTTGACTCTGTCGAGCTCTCTTGCCATGGCCCAGTCTGCAGCTCTTTTG
AAAGTGCCTTCGACTGAACACAGCCCTTTTCCGATGAAGCCACAAACTCCAGCAGTCTAT
TCTCTTGAAGACCATCCTCGACTTTCTCACCCATCCTTTCAGATACAAAACTTTCGTAGC
TTGAACAACTAGACTCATTATCTGAATGCAAACGATTGCAGTTGGTTTTTACAAAAAAGT
GACTCTGAATGATTGCCTTTGCTGGTGTATGTTCTTCATCTAAGTCAC
■■Homology search results ■■ -
sp_hit_id P34100
Definition sp|P34100|PKD1_DICDI Developmentally-regulated protein kinase 1 OS=Dictyostelium discoideum
Align length 64
Score (bit) 29.3
E-value 6.3
Report
BLASTX 2.2.19 [Nov-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.

Query= BP917238|Adiantum capillus-veneris mRNA, clone:
YMU001_000098_A12.
(288 letters)

Database: uniprot_sprot.fasta
412,525 sequences; 148,809,765 total letters

Searching..................................................done



Score E
Sequences producing significant alignments: (bits) Value

sp|P34100|PKD1_DICDI Developmentally-regulated protein kinase 1 ... 29 6.3

>sp|P34100|PKD1_DICDI Developmentally-regulated protein kinase 1
OS=Dictyostelium discoideum GN=pkaD PE=2 SV=2
Length = 714

Score = 29.3 bits (64), Expect = 6.3
Identities = 22/64 (34%), Positives = 33/64 (51%), Gaps = 6/64 (9%)
Frame = +1

Query: 67 PSTEHSPFPMKPQTPAVYSLEDHPR--LSHPSF--QIQNFRSLNN*THYLNANDC--SWF 228
PS+ +P P +P S+ HP LS +F Q+QN + NN ++ N N+ + F
Sbjct: 209 PSSNSTPSHSSPSSPTTSSIPFHPNFTLSQDNFNQQLQNNNNSNNNSNNNNNNNIINNNF 268

Query: 229 LQKS 240
LQ S
Sbjct: 269 LQNS 272


tr_hit_id -
Definition No hits.
Align length -
Score (bit) -
E-value -
Report
BLASTX 2.2.19 [Nov-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.

Query= BP917238|Adiantum capillus-veneris mRNA, clone:
YMU001_000098_A12.
(288 letters)

Database: uniprot_trembl.fasta
7,341,751 sequences; 2,391,615,440 total letters

Searching..................................................done

***** No hits found ******