| BP917252 | |
| Clone id | YMU001_000098_C05 |
| Library | YMU01 |
| Length | 210 |
| Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000098_C05. |
| Accession | BP917252 |
| Tissue type | prothallium |
| Developmental stage | - |
| Contig ID | - |
| Sequence | GAATGCAAGCGGCATAAGTCCATGGTTAGCTTTTCGCAACATCGCAAGTCGAGGTGTGTT |
| ■■Homology search results ■■ | - |
| Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
| sp_hit_id | P52544 |
| Definition | sp|P52544|PRTP_HHV6Z Probable processing and transport protein OS=Human herpesvirus 6B (strain Z29) |
| Align length | 31 |
| Score (bit) | 30.8 |
| E-value | 2.2 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
| TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
| tr_hit_id | - |
| Definition | No hits. |
| Align length | - |
| Score (bit) | - |
| E-value | - |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |