BP917304 | |
Clone id | YMU001_000099_B01 |
Library | YMU01 |
Length | 494 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000099_B01. |
Accession | BP917304 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | - |
Sequence | TCAATCCCAAGTACTATGATGGAAGCCACGTAAGGATGTTGGAAGTTCTGCTTGCTATGA |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | - |
Definition | No hits. |
Align length | - |
Score (bit) | - |
E-value | - |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | A7P3D8 |
Definition | tr|A7P3D8|A7P3D8_VITVI Chromosome chr1 scaffold_5, whole genome shotgun sequence OS=Vitis vinifera |
Align length | 73 |
Score (bit) | 92.0 |
E-value | 1.0e-17 |
Report | BLASTX 2.2.19 [Nov-02-2008] |