| BP917304 | |
| Clone id | YMU001_000099_B01 |
| Library | YMU01 |
| Length | 494 |
| Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000099_B01. |
| Accession | BP917304 |
| Tissue type | prothallium |
| Developmental stage | - |
| Contig ID | - |
| Sequence | TCAATCCCAAGTACTATGATGGAAGCCACGTAAGGATGTTGGAAGTTCTGCTTGCTATGA |
| ■■Homology search results ■■ | - |
| Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
| sp_hit_id | - |
| Definition | No hits. |
| Align length | - |
| Score (bit) | - |
| E-value | - |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
| TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
| tr_hit_id | A7P3D8 |
| Definition | tr|A7P3D8|A7P3D8_VITVI Chromosome chr1 scaffold_5, whole genome shotgun sequence OS=Vitis vinifera |
| Align length | 73 |
| Score (bit) | 92.0 |
| E-value | 1.0e-17 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |