| BP917375 | |
| Clone id | YMU001_000100_A10 |
| Library | YMU01 |
| Length | 459 |
| Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000100_A10. |
| Accession | BP917375 |
| Tissue type | prothallium |
| Developmental stage | - |
| Contig ID | - |
| Sequence | GGCAGTGTCAGTTATCAGGACATACAGTACCTAATATACAAGCCATATGAGCAGGCCATT |
| ■■Homology search results ■■ | - |
| Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
| sp_hit_id | A1VBE9 |
| Definition | sp|A1VBE9|MURC_DESVV UDP-N-acetylmuramate--L-alanine ligase OS=Desulfovibrio vulgaris subsp. vulgaris (strain DP4) |
| Align length | 23 |
| Score (bit) | 30.0 |
| E-value | 5.0 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
| TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
| tr_hit_id | A9RV90 |
| Definition | tr|A9RV90|A9RV90_PHYPA Predicted protein OS=Physcomitrella patens subsp. patens |
| Align length | 71 |
| Score (bit) | 82.0 |
| E-value | 1.0e-14 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |