BP917554 | |
Clone id | YMU001_000102_C12 |
Library | YMU01 |
Length | 424 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000102_C12. |
Accession | BP917554 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | - |
Sequence | GCTTAAGTTGTAGAAAGTTCAACGATGACCTTGTTTTTGTTACACCTATGACTTCACAAT |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | Q8CF25 |
Definition | sp|Q8CF25|CS067_MOUSE UPF0575 protein C19orf67 homolog OS=Mus musculus |
Align length | 103 |
Score (bit) | 30.4 |
E-value | 3.0 |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | Q4UBX5 |
Definition | tr|Q4UBX5|Q4UBX5_THEAN Putative uncharacterized protein OS=Theileria annulata |
Align length | 44 |
Score (bit) | 33.1 |
E-value | 7.0 |
Report | BLASTX 2.2.19 [Nov-02-2008] |