| BP917554 | |
| Clone id | YMU001_000102_C12 |
| Library | YMU01 |
| Length | 424 |
| Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000102_C12. |
| Accession | BP917554 |
| Tissue type | prothallium |
| Developmental stage | - |
| Contig ID | - |
| Sequence | GCTTAAGTTGTAGAAAGTTCAACGATGACCTTGTTTTTGTTACACCTATGACTTCACAAT |
| ■■Homology search results ■■ | - |
| Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
| sp_hit_id | Q8CF25 |
| Definition | sp|Q8CF25|CS067_MOUSE UPF0575 protein C19orf67 homolog OS=Mus musculus |
| Align length | 103 |
| Score (bit) | 30.4 |
| E-value | 3.0 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
| TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
| tr_hit_id | Q4UBX5 |
| Definition | tr|Q4UBX5|Q4UBX5_THEAN Putative uncharacterized protein OS=Theileria annulata |
| Align length | 44 |
| Score (bit) | 33.1 |
| E-value | 7.0 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |