BP917567 | |
Clone id | YMU001_000102_E03 |
Library | YMU01 |
Length | 513 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000102_E03. |
Accession | BP917567 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | CL1351Contig1 |
Sequence | TCTACATAGAATCATTGAACACAGGACTTTAAGCTAAATGCTCGCGGTCGTAGGTGCTCT |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | - |
Definition | No hits. |
Align length | - |
Score (bit) | - |
E-value | - |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | Q9U8G0 |
Definition | tr|Q9U8G0|Q9U8G0_PLAFA Erythrocyte membrane protein 3 (Fragment) OS=Plasmodium falciparum |
Align length | 118 |
Score (bit) | 36.6 |
E-value | 0.74 |
Report | BLASTX 2.2.19 [Nov-02-2008] |