| BP917613 |
| Clone id |
YMU001_000103_B06 |
| Library |
YMU01 |
| Length |
148 |
| Definition |
Adiantum capillus-veneris mRNA. clone: YMU001_000103_B06. |
| Accession |
BP917613 |
| Tissue type |
prothallium |
| Developmental stage |
- |
| Contig ID |
- |
| Sequence |
GTGGTCCATAACTTTCACCACAAATGTCCGAAAGCCATCAAACTTCTTGCACATCACTTG TAACTCATACACTTCCTATGCATTCAATATGGCAGCATTTGACATGCATTGACACACATC TTCATCTTAGGCGTGCCTAAGATAAAGT |
| ■■Homology search results ■■ |
- |
| Swiss-Prot (release 56.9) |
Link to BlastX Result : Swiss-Prot |
| sp_hit_id |
Q992J0 |
| Definition |
sp|Q992J0|RDRP_BOOLV RNA-directed RNA polymerase OS=Boolarra virus |
| Align length |
25 |
| Score (bit) |
28.9 |
| E-value |
8.2 |
| Report |
 |
| TrEMBL (release 39.9) |
Link to BlastX Result : TrEMBL |
| tr_hit_id |
- |
| Definition |
No hits. |
| Align length |
- |
| Score (bit) |
- |
| E-value |
- |
| Report |
 |