BP917660 | |
Clone id | YMU001_000103_H04 |
Library | YMU01 |
Length | 134 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000103_H04. |
Accession | BP917660 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | - |
Sequence | GGAAATACATTATAAAAGTGATATACTTCTTCTTGGTCAAATACAGCAACTTCTGTCCCA |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | Q56P03 |
Definition | sp|Q56P03|EAPP_HUMAN E2F-associated phosphoprotein OS=Homo sapiens |
Align length | 34 |
Score (bit) | 49.3 |
E-value | 6.0e-06 |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | B6TFE2 |
Definition | tr|B6TFE2|B6TFE2_MAIZE Putative uncharacterized protein OS=Zea mays |
Align length | 35 |
Score (bit) | 54.3 |
E-value | 3.0e-06 |
Report | BLASTX 2.2.19 [Nov-02-2008] |