BP917975
Clone id YMU001_000108_B01
Library
Length 333
Definition Adiantum capillus-veneris mRNA. clone: YMU001_000108_B01.
Accession
Tissue type prothallium
Developmental stage -
Contig ID -
Sequence
AGAGCAGCAACATCGTCTTGTCGGCCACTATGAGGCAAAGCAATTTGAGATTTCGACAGA
AGCAGCTCTGAGAAGGTACAGAATCGGGGAAACCCTAGCTTTGCAATGACCAGTGCTGAA
CCGTTTCTGTCAAGCTCTAAATTCGCCCTGGCAAGCTTGCCATGGAGAGGCAGACTGTCA
AGATCGTCCTTGCGGAGATCCCTGAGGAGGATTAATGGAAGCTTGGGGAGCTTGGCGAGG
AGCGAGGGCAAGGAAGCGACAAATTTGGCTTTAGAATCGGAGGCCTGCTTAGCGATTTCT
GCGGGAGTGTTGAGAGGGTTAGTGGTGGTAACA
■■Homology search results ■■ -
sp_hit_id Q10S72
Definition sp|Q10S72|4CLL4_ORYSJ 4-coumarate--CoA ligase-like 4 OS=Oryza sativa subsp. japonica
Align length 21
Score (bit) 36.6
E-value 0.04
Report
BLASTX 2.2.19 [Nov-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.

Query= BP917975|Adiantum capillus-veneris mRNA, clone:
YMU001_000108_B01.
(333 letters)

Database: uniprot_sprot.fasta
412,525 sequences; 148,809,765 total letters

Searching..................................................done



Score E
Sequences producing significant alignments: (bits) Value

sp|Q10S72|4CLL4_ORYSJ 4-coumarate--CoA ligase-like 4 OS=Oryza sa... 37 0.040
sp|Q0DV32|4CLL1_ORYSJ 4-coumarate--CoA ligase-like 1 OS=Oryza sa... 34 0.20
sp|Q84P21|4CLL5_ARATH 4-coumarate--CoA ligase-like 5 OS=Arabidop... 33 0.34
sp|P31685|4CL2_SOLTU 4-coumarate--CoA ligase 2 OS=Solanum tubero... 32 0.99
sp|P31684|4CL1_SOLTU 4-coumarate--CoA ligase 1 OS=Solanum tubero... 32 0.99
sp|O24146|4CL2_TOBAC 4-coumarate--CoA ligase 2 OS=Nicotiana taba... 32 1.3
sp|O24145|4CL1_TOBAC 4-coumarate--CoA ligase 1 OS=Nicotiana taba... 32 1.3
sp|Q6ZAC1|4CL5_ORYSJ Probable 4-coumarate--CoA ligase 5 OS=Oryza... 31 1.7
sp|Q9S725|4CL2_ARATH 4-coumarate--CoA ligase 2 OS=Arabidopsis th... 31 1.7
sp|Q84P26|4CLL8_ARATH 4-coumarate--CoA ligase-like 8 OS=Arabidop... 31 2.2
sp|Q42524|4CL1_ARATH 4-coumarate--CoA ligase 1 OS=Arabidopsis th... 31 2.2
sp|Q84P25|4CLL2_ARATH 4-coumarate--CoA ligase-like 2 OS=Arabidop... 30 2.9
sp|P41636|4CL_PINTA 4-coumarate--CoA ligase OS=Pinus taeda GN=4C... 29 6.4
sp|Q9LU36|4CL4_ARATH 4-coumarate--CoA ligase 4 OS=Arabidopsis th... 29 6.4

>sp|Q10S72|4CLL4_ORYSJ 4-coumarate--CoA ligase-like 4 OS=Oryza
sativa subsp. japonica GN=4CLL4 PE=2 SV=1
Length = 552

Score = 36.6 bits (83), Expect = 0.040
Identities = 15/21 (71%), Positives = 19/21 (90%)
Frame = -2

Query: 332 VTTTNPLNTPAEIAKQASDSK 270
+TT NPLNTPAEIAKQ +D++
Sbjct: 116 LTTANPLNTPAEIAKQVADAR 136


>sp|Q0DV32|4CLL1_ORYSJ 4-coumarate--CoA ligase-like 1 OS=Oryza
sativa subsp. japonica GN=4CLL1 PE=2 SV=2
Length = 552

Score = 34.3 bits (77), Expect = 0.20
Identities = 16/24 (66%), Positives = 18/24 (75%)
Frame = -2

Query: 329 TTTNPLNTPAEIAKQASDSKAKFV 258
TT NP TP EIAKQ SD++AK V
Sbjct: 114 TTVNPDYTPREIAKQVSDARAKLV 137


>sp|Q84P21|4CLL5_ARATH 4-coumarate--CoA ligase-like 5 OS=Arabidopsis
thaliana GN=4CLL5 PE=1 SV=2
Length = 546

Score = 33.5 bits (75), Expect = 0.34
Identities = 15/20 (75%), Positives = 16/20 (80%)
Frame = -2

Query: 332 VTTTNPLNTPAEIAKQASDS 273
+TTTNPLNT EIAKQ DS
Sbjct: 109 ITTTNPLNTSNEIAKQIKDS 128


>sp|P31685|4CL2_SOLTU 4-coumarate--CoA ligase 2 OS=Solanum tuberosum
GN=4CL2 PE=3 SV=1
Length = 545

Score = 32.0 bits (71), Expect = 0.99
Identities = 15/24 (62%), Positives = 16/24 (66%)
Frame = -2

Query: 329 TTTNPLNTPAEIAKQASDSKAKFV 258
T NPL TPAE+ KQA S AK V
Sbjct: 108 TMANPLFTPAEVVKQAKASSAKIV 131


>sp|P31684|4CL1_SOLTU 4-coumarate--CoA ligase 1 OS=Solanum tuberosum
GN=4CL1 PE=3 SV=1
Length = 545

Score = 32.0 bits (71), Expect = 0.99
Identities = 15/24 (62%), Positives = 16/24 (66%)
Frame = -2

Query: 329 TTTNPLNTPAEIAKQASDSKAKFV 258
T NPL TPAE+ KQA S AK V
Sbjct: 108 TMANPLFTPAEVVKQAKASSAKIV 131


>sp|O24146|4CL2_TOBAC 4-coumarate--CoA ligase 2 OS=Nicotiana tabacum
GN=4CL2 PE=2 SV=1
Length = 542

Score = 31.6 bits (70), Expect = 1.3
Identities = 14/24 (58%), Positives = 16/24 (66%)
Frame = -2

Query: 329 TTTNPLNTPAEIAKQASDSKAKFV 258
T NPL TPAE+ KQA S AK +
Sbjct: 105 TMANPLFTPAEVVKQAKASSAKII 128


>sp|O24145|4CL1_TOBAC 4-coumarate--CoA ligase 1 OS=Nicotiana tabacum
GN=4CL1 PE=2 SV=1
Length = 547

Score = 31.6 bits (70), Expect = 1.3
Identities = 14/24 (58%), Positives = 16/24 (66%)
Frame = -2

Query: 329 TTTNPLNTPAEIAKQASDSKAKFV 258
T NPL TPAE+ KQA S AK +
Sbjct: 110 TMANPLFTPAEVVKQAKASSAKII 133


>sp|Q6ZAC1|4CL5_ORYSJ Probable 4-coumarate--CoA ligase 5 OS=Oryza
sativa subsp. japonica GN=4CL5 PE=2 SV=1
Length = 539

Score = 31.2 bits (69), Expect = 1.7
Identities = 15/24 (62%), Positives = 17/24 (70%)
Frame = -2

Query: 329 TTTNPLNTPAEIAKQASDSKAKFV 258
TT NPL+TP EIAKQ + S A V
Sbjct: 103 TTANPLHTPPEIAKQVAASGATVV 126


>sp|Q9S725|4CL2_ARATH 4-coumarate--CoA ligase 2 OS=Arabidopsis
thaliana GN=4CL2 PE=1 SV=2
Length = 556

Score = 31.2 bits (69), Expect = 1.7
Identities = 14/24 (58%), Positives = 17/24 (70%)
Frame = -2

Query: 329 TTTNPLNTPAEIAKQASDSKAKFV 258
T+ NP TPAEI+KQA S AK +
Sbjct: 116 TSANPFFTPAEISKQAKASAAKLI 139


>sp|Q84P26|4CLL8_ARATH 4-coumarate--CoA ligase-like 8 OS=Arabidopsis
thaliana GN=4CLL8 PE=2 SV=2
Length = 550

Score = 30.8 bits (68), Expect = 2.2
Identities = 13/23 (56%), Positives = 17/23 (73%)
Frame = -2

Query: 332 VTTTNPLNTPAEIAKQASDSKAK 264
+TT NPLNT +EI +Q +DS K
Sbjct: 117 LTTANPLNTASEILRQIADSNPK 139


tr_hit_id B6E466
Definition tr|B6E466|B6E466_LEUGL 4-coumarate CoA ligase 1 OS=Leucaena glauca
Align length 25
Score (bit) 39.3
E-value 0.1
Report
BLASTX 2.2.19 [Nov-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.

Query= BP917975|Adiantum capillus-veneris mRNA, clone:
YMU001_000108_B01.
(333 letters)

Database: uniprot_trembl.fasta
7,341,751 sequences; 2,391,615,440 total letters

Searching..................................................done



Score E
Sequences producing significant alignments: (bits) Value

tr|B6E466|B6E466_LEUGL 4-coumarate CoA ligase 1 OS=Leucaena glau... 39 0.10
tr|A7NVS9|A7NVS9_VITVI Chromosome chr18 scaffold_1, whole genome... 37 0.38
tr|B6SV48|B6SV48_MAIZE 4-coumarate--CoA ligase 2 OS=Zea mays PE=... 37 0.50
tr|A7REI2|A7REI2_LEUGL 4-coumarate:CoA ligase (Fragment) OS=Leuc... 37 0.50
tr|O48869|O48869_POPJC 4-coumarate:CoA ligase 1 OS=Populus jacki... 37 0.65
tr|B7EYA8|B7EYA8_ORYSJ cDNA clone:001-202-E07, full insert seque... 37 0.65
tr|B4G058|B4G058_MAIZE Putative uncharacterized protein OS=Zea m... 37 0.65
tr|A3ADT7|A3ADT7_ORYSJ Putative uncharacterized protein OS=Oryza... 37 0.65
tr|A2XC42|A2XC42_ORYSI Putative uncharacterized protein OS=Oryza... 37 0.65
tr|Q9LL49|Q9LL49_RUBID 4-coumarate:coA ligase 1 OS=Rubus idaeus ... 35 2.5
tr|Q9LKM9|Q9LKM9_RUBID 4-coumarate-CoA ligase 1 (Fragment) OS=Ru... 35 2.5
tr|A7NVS8|A7NVS8_VITVI Chromosome chr18 scaffold_1, whole genome... 35 2.5
tr|A5B2E7|A5B2E7_VITVI Putative uncharacterized protein OS=Vitis... 35 2.5
tr|Q9LL50|Q9LL50_RUBID 4-coumarate:coA ligase 2 OS=Rubus idaeus ... 34 3.2
tr|Q9LKM8|Q9LKM8_RUBID 4-coumarate-CoA ligase 2 (Fragment) OS=Ru... 34 3.2
tr|Q8S564|Q8S564_SOYBN 4-coumarate:coenzyme A ligase OS=Glycine ... 34 3.2
tr|Q3YAU2|Q3YAU2_EUCCA 4-coumarate:coenzyme A ligase OS=Eucalypt... 34 3.2
tr|B8AND5|B8AND5_ORYSI Putative uncharacterized protein OS=Oryza... 34 3.2
tr|B7F991|B7F991_ORYSJ cDNA, clone: J075140K23, full insert sequ... 34 3.2
tr|B2Z6P1|B2Z6P1_POPTR 4-coumarate:CoA ligase OS=Populus trichoc... 34 3.2
tr|A8R7L9|A8R7L9_EUCGG 4-coumarate:coenzyme A ligase OS=Eucalypt... 34 3.2
tr|A3AE78|A3AE78_ORYSJ Putative uncharacterized protein OS=Oryza... 34 3.2
tr|A5BPU4|A5BPU4_VITVI Putative uncharacterized protein (Chromos... 34 4.2
tr|B1VKP2|B1VKP2_STRGG Putative 4-coumarate:CoA ligase OS=Strept... 33 5.5
tr|Q3ED88|Q3ED88_ARATH Uncharacterized protein At1g20510.2 OS=Ar... 33 5.5
tr|B4FAY2|B4FAY2_MAIZE Putative uncharacterized protein OS=Zea m... 33 9.4
tr|B2Z6P0|B2Z6P0_POPTR 4-coumarate:CoA ligase OS=Populus trichoc... 33 9.4
tr|A7PQS6|A7PQS6_VITVI Chromosome chr6 scaffold_25, whole genome... 33 9.4
tr|B4JL04|B4JL04_DROGR GH11952 OS=Drosophila grimshawi GN=GH1195... 33 9.4

>tr|B6E466|B6E466_LEUGL 4-coumarate CoA ligase 1 OS=Leucaena glauca
PE=2 SV=1
Length = 542

Score = 39.3 bits (90), Expect = 0.10
Identities = 17/25 (68%), Positives = 22/25 (88%)
Frame = -2

Query: 332 VTTTNPLNTPAEIAKQASDSKAKFV 258
VTT NPL+TPAE+AKQA+ SK+K +
Sbjct: 102 VTTANPLSTPAELAKQATASKSKLI 126


>tr|A7NVS9|A7NVS9_VITVI Chromosome chr18 scaffold_1, whole genome
shotgun sequence OS=Vitis vinifera GN=GSVIVT00015554001
PE=3 SV=1
Length = 542

Score = 37.4 bits (85), Expect = 0.38
Identities = 18/25 (72%), Positives = 18/25 (72%)
Frame = -2

Query: 332 VTTTNPLNTPAEIAKQASDSKAKFV 258
VTTTNPLNTP EI KQ DSK V
Sbjct: 114 VTTTNPLNTPREIGKQIVDSKPVLV 138


>tr|B6SV48|B6SV48_MAIZE 4-coumarate--CoA ligase 2 OS=Zea mays PE=2
SV=1
Length = 520

Score = 37.0 bits (84), Expect = 0.50
Identities = 16/22 (72%), Positives = 19/22 (86%)
Frame = -2

Query: 329 TTTNPLNTPAEIAKQASDSKAK 264
TT NPL TP E+AKQA+DS+AK
Sbjct: 78 TTANPLYTPREVAKQATDSRAK 99


>tr|A7REI2|A7REI2_LEUGL 4-coumarate:CoA ligase (Fragment)
OS=Leucaena glauca GN=4CL PE=2 SV=1
Length = 409

Score = 37.0 bits (84), Expect = 0.50
Identities = 16/25 (64%), Positives = 20/25 (80%)
Frame = -2

Query: 332 VTTTNPLNTPAEIAKQASDSKAKFV 258
VTT NP TPAE+AKQA+ SK+K +
Sbjct: 72 VTTANPFFTPAELAKQATSSKSKLI 96


>tr|O48869|O48869_POPJC 4-coumarate:CoA ligase 1 OS=Populus jackii
GN=4CL1 PE=2 SV=1
Length = 557

Score = 36.6 bits (83), Expect = 0.65
Identities = 16/24 (66%), Positives = 19/24 (79%)
Frame = -2

Query: 329 TTTNPLNTPAEIAKQASDSKAKFV 258
TT NP TPAE+AKQA+ SKAK +
Sbjct: 106 TTANPFYTPAEVAKQATASKAKLI 129


>tr|B7EYA8|B7EYA8_ORYSJ cDNA clone:001-202-E07, full insert sequence
OS=Oryza sativa subsp. japonica PE=2 SV=1
Length = 552

Score = 36.6 bits (83), Expect = 0.65
Identities = 15/21 (71%), Positives = 19/21 (90%)
Frame = -2

Query: 332 VTTTNPLNTPAEIAKQASDSK 270
+TT NPLNTPAEIAKQ +D++
Sbjct: 116 LTTANPLNTPAEIAKQVADAR 136


>tr|B4G058|B4G058_MAIZE Putative uncharacterized protein OS=Zea mays
PE=2 SV=1
Length = 551

Score = 36.6 bits (83), Expect = 0.65
Identities = 15/21 (71%), Positives = 19/21 (90%)
Frame = -2

Query: 332 VTTTNPLNTPAEIAKQASDSK 270
+TT NPLNTPAEIAKQ +D++
Sbjct: 112 LTTANPLNTPAEIAKQVADAR 132


>tr|A3ADT7|A3ADT7_ORYSJ Putative uncharacterized protein OS=Oryza
sativa subsp. japonica GN=OsJ_008959 PE=3 SV=1
Length = 578

Score = 36.6 bits (83), Expect = 0.65
Identities = 15/21 (71%), Positives = 19/21 (90%)
Frame = -2

Query: 332 VTTTNPLNTPAEIAKQASDSK 270
+TT NPLNTPAEIAKQ +D++
Sbjct: 116 LTTANPLNTPAEIAKQVADAR 136


>tr|A2XC42|A2XC42_ORYSI Putative uncharacterized protein OS=Oryza
sativa subsp. indica GN=OsI_09863 PE=3 SV=1
Length = 565

Score = 36.6 bits (83), Expect = 0.65
Identities = 15/21 (71%), Positives = 19/21 (90%)
Frame = -2

Query: 332 VTTTNPLNTPAEIAKQASDSK 270
+TT NPLNTPAEIAKQ +D++
Sbjct: 116 LTTANPLNTPAEIAKQVADAR 136


>tr|Q9LL49|Q9LL49_RUBID 4-coumarate:coA ligase 1 OS=Rubus idaeus
PE=2 SV=1
Length = 543

Score = 34.7 bits (78), Expect = 2.5
Identities = 16/25 (64%), Positives = 18/25 (72%)
Frame = -2

Query: 332 VTTTNPLNTPAEIAKQASDSKAKFV 258
+T NP TPAEIAKQA SKAK +
Sbjct: 104 MTAANPFFTPAEIAKQAKASKAKLI 128