BP918075
Clone id YMU001_000109_C11
Library
Length 473
Definition Adiantum capillus-veneris mRNA. clone: YMU001_000109_C11.
Accession
Tissue type prothallium
Developmental stage -
Contig ID -
Sequence
CAATTACAATGCTGTCTGAGGGAGGCACCTCACGTTCATTTAACTTAATGGTTAACCCAT
CTCTTATGATCAACTTTGGTTCTTTGAAACCTTTAGTTGCCTTGAAGGCTTTGACGTATA
GCTTCCTCAAGCTCTGCTGCTTCAATCTCCATTAAACTTCTATCAACAGTTTCAGGACTA
TCTACTCCGGTTGAGGTGAGAACATTGGTCCCAACTTCGCACTCTGCTACCATGGCTGGA
GCATTTTTCACCACATCAATATTGATGCTGTCTACAGGTGAAGCATCATCTTCCCATTCG
ATTTCTTCACTCTCGGAAATAACATCTGGACGCAAGTTCTGCACCTCAATACCCTCTGCT
AAGAGATCATCTTGGTCAATCTCAATAGTTATGACACCACCCTTAACAGGCTGACTAGAT
GCAGGAACTACACATTCAATCCCATCCTCCCACACGATATCACTATCCTCTAC
■■Homology search results ■■ -
sp_hit_id Q8SX83
Definition sp|Q8SX83|SPEN_DROME Protein split ends OS=Drosophila melanogaster
Align length 75
Score (bit) 33.5
E-value 0.49
Report
BLASTX 2.2.19 [Nov-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.

Query= BP918075|Adiantum capillus-veneris mRNA, clone:
YMU001_000109_C11.
(473 letters)

Database: uniprot_sprot.fasta
412,525 sequences; 148,809,765 total letters

Searching..................................................done



Score E
Sequences producing significant alignments: (bits) Value

sp|Q8SX83|SPEN_DROME Protein split ends OS=Drosophila melanogast... 33 0.49
sp|Q9J508|V227_FOWPV Putative ankyrin repeat protein FPV227 OS=F... 30 5.4
sp|Q6W8W5|POL1_ARMVN RNA1 polyprotein OS=Arabis mosaic virus (is... 30 7.1

>sp|Q8SX83|SPEN_DROME Protein split ends OS=Drosophila melanogaster
GN=spen PE=1 SV=2
Length = 5560

Score = 33.5 bits (75), Expect = 0.49
Identities = 21/75 (28%), Positives = 36/75 (48%)
Frame = +2

Query: 239 EHFSPHQY*CCLQVKHHLPIRFLHSRK*HLDASSAPQYPLLRDHLGQSQ*L*HHP*QAD* 418
+H + +Q + H+ + LH + + +SAPQ+ + + H Q Q H+ Q
Sbjct: 3831 QHMQQFMHQQMIQRQQHMQQQQLHGQSQQI--TSAPQHQMHQQHQAQQQQQHHN--QQHL 3886

Query: 419 MQELHIQSHPPTRYH 463
Q+LH Q HP + H
Sbjct: 3887 NQQLHAQQHPTQKQH 3901


>sp|Q9J508|V227_FOWPV Putative ankyrin repeat protein FPV227
OS=Fowlpox virus GN=FPV227 PE=4 SV=1
Length = 361

Score = 30.0 bits (66), Expect = 5.4
Identities = 12/23 (52%), Positives = 18/23 (78%)
Frame = -2

Query: 343 CRTCVQMLFPRVKKSNGKMMLHL 275
CR CV+MLF VK +N ++++HL
Sbjct: 23 CRYCVRMLFNAVKFNNIRLVMHL 45


>sp|Q6W8W5|POL1_ARMVN RNA1 polyprotein OS=Arabis mosaic virus (isolate
NW) PE=3 SV=1
Length = 2284

Score = 29.6 bits (65), Expect = 7.1
Identities = 14/38 (36%), Positives = 22/38 (57%)
Frame = +2

Query: 242 HFSPHQY*CCLQVKHHLPIRFLHSRK*HLDASSAPQYP 355
HF+P Y C++V RFLH++ ++D+ PQ P
Sbjct: 912 HFTPRAYDNCIEV------RFLHNKCAYVDSEGIPQGP 943


tr_hit_id Q6G2Z1
Definition tr|Q6G2Z1|Q6G2Z1_BARHE Serine protease OS=Bartonella henselae
Align length 70
Score (bit) 33.1
E-value 7.1
Report
BLASTX 2.2.19 [Nov-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.

Query= BP918075|Adiantum capillus-veneris mRNA, clone:
YMU001_000109_C11.
(473 letters)

Database: uniprot_trembl.fasta
7,341,751 sequences; 2,391,615,440 total letters

Searching..................................................done



Score E
Sequences producing significant alignments: (bits) Value

tr|Q6G2Z1|Q6G2Z1_BARHE Serine protease OS=Bartonella henselae GN... 33 7.1

>tr|Q6G2Z1|Q6G2Z1_BARHE Serine protease OS=Bartonella henselae
GN=htrA2 PE=4 SV=1
Length = 463

Score = 33.1 bits (74), Expect = 7.1
Identities = 22/70 (31%), Positives = 35/70 (50%), Gaps = 2/70 (2%)
Frame = -1

Query: 353 GIEVQNLRPDVXXXXXXXXXXXDASPVDSINIDVVKNAPAMVAECEVGTNVLTSTG--VD 180
G QN+ PD+ P ++ I+V+K++PA A VG +L+ G VD
Sbjct: 268 GASFQNVTPDIAGGLGLER------PYGALVIEVIKDSPAKKAGLRVGDVILSVQGIRVD 321

Query: 179 SPETVDRSLM 150
SP+++ LM
Sbjct: 322 SPDSLGYRLM 331