| BP918078 | |
| Clone id | YMU001_000109_D02 |
| Library | YMU01 |
| Length | 544 |
| Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000109_D02. |
| Accession | BP918078 |
| Tissue type | prothallium |
| Developmental stage | - |
| Contig ID | - |
| Sequence | ATCGAAGGTTAGCTCATCGCTAATAAAGTGAGCTAATTAGTACTTTAATGACAAGCTGCA |
| ■■Homology search results ■■ | - |
| Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
| sp_hit_id | A8MI49 |
| Definition | sp|A8MI49|CINA_ALKOO Putative competence-damage inducible protein OS=Alkaliphilus oremlandii (strain OhILAs) |
| Align length | 71 |
| Score (bit) | 29.6 |
| E-value | 9.9 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
| TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
| tr_hit_id | A7QP22 |
| Definition | tr|A7QP22|A7QP22_VITVI Chromosome chr1 scaffold_135, whole genome shotgun sequence OS=Vitis vinifera |
| Align length | 55 |
| Score (bit) | 75.9 |
| E-value | 1.0e-12 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |