BP918078 | |
Clone id | YMU001_000109_D02 |
Library | YMU01 |
Length | 544 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000109_D02. |
Accession | BP918078 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | - |
Sequence | ATCGAAGGTTAGCTCATCGCTAATAAAGTGAGCTAATTAGTACTTTAATGACAAGCTGCA |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | A8MI49 |
Definition | sp|A8MI49|CINA_ALKOO Putative competence-damage inducible protein OS=Alkaliphilus oremlandii (strain OhILAs) |
Align length | 71 |
Score (bit) | 29.6 |
E-value | 9.9 |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | A7QP22 |
Definition | tr|A7QP22|A7QP22_VITVI Chromosome chr1 scaffold_135, whole genome shotgun sequence OS=Vitis vinifera |
Align length | 55 |
Score (bit) | 75.9 |
E-value | 1.0e-12 |
Report | BLASTX 2.2.19 [Nov-02-2008] |