| BP918672 | |
| Clone id | YMU001_000116_B12 |
| Library | YMU01 |
| Length | 554 |
| Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000116_B12. |
| Accession | BP918672 |
| Tissue type | prothallium |
| Developmental stage | - |
| Contig ID | CL2191Contig1 |
| Sequence | GATCAACACCTCCCTCTACCACAGTACCACTCCAGCTCTTGGATGACTTAACTATCCCCA |
| ■■Homology search results ■■ | - |
| Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
| sp_hit_id | Q6P3X8 |
| Definition | sp|Q6P3X8|PGBD2_HUMAN PiggyBac transposable element-derived protein 2 OS=Homo sapiens |
| Align length | 75 |
| Score (bit) | 30.0 |
| E-value | 7.9 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
| TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
| tr_hit_id | Q8L0X1 |
| Definition | tr|Q8L0X1|Q8L0X1_9GAMM Acyl-CoA dehydrogenase B OS=Acinetobacter sp. M-1 |
| Align length | 74 |
| Score (bit) | 39.3 |
| E-value | 0.14 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |