BP918777
Clone id YMU001_000117_D03
Library
Length 303
Definition Adiantum capillus-veneris mRNA. clone: YMU001_000117_D03.
Accession
Tissue type prothallium
Developmental stage -
Contig ID -
Sequence
TTCCGCAGCTCCCCATAACTATGCTAGCTTTGGTTCAAGTATGTCCTGAAGTCTTTGCTA
CTTGTTACCCCTCACAATGTGGACAGCCACGTTATGTAATACTTCTCTCTGTTTCGCTTT
GAGATTTTTCAAGGCCACTAGAACGATTGTCTTTTTAATTTTTTGGCTTTTATTCACTCT
ATAATGACTTCCATAGGCTTGCTTAGGTGAGGATGCACAAGGTTATTTGGTCACTCTTAC
AAAAAGTTGATTGCCGCCTACAAATGCGCAACTAGTTGCATGAATTGCTTGGATGCACAA
TGT
■■Homology search results ■■ -
sp_hit_id Q8K984
Definition sp|Q8K984|MDLB_BUCAP Multidrug resistance-like ATP-binding protein mdlB OS=Buchnera aphidicola subsp. Schizaphis graminum
Align length 68
Score (bit) 30.0
E-value 3.8
Report
BLASTX 2.2.19 [Nov-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.

Query= BP918777|Adiantum capillus-veneris mRNA, clone:
YMU001_000117_D03.
(303 letters)

Database: uniprot_sprot.fasta
412,525 sequences; 148,809,765 total letters

Searching..................................................done



Score E
Sequences producing significant alignments: (bits) Value

sp|Q8K984|MDLB_BUCAP Multidrug resistance-like ATP-binding prote... 30 3.8

>sp|Q8K984|MDLB_BUCAP Multidrug resistance-like ATP-binding protein
mdlB OS=Buchnera aphidicola subsp. Schizaphis graminum
GN=mdlB PE=3 SV=1
Length = 580

Score = 30.0 bits (66), Expect = 3.8
Identities = 22/68 (32%), Positives = 34/68 (50%), Gaps = 4/68 (5%)
Frame = -1

Query: 267 AFVGGNQLFVRVTK*PCASSPKQAYGSHYRVNKSQKIKKTIVLVALKNLKAKQRE----V 100
A V G ++F + SPKQ YG++ KS KI +KNL K +E +
Sbjct: 311 AIVAGERIFSLI------DSPKQKYGNNEEEIKSGKIN-------IKNLSFKYKESGENI 357

Query: 99 LHNVAVHI 76
L+N+ ++I
Sbjct: 358 LNNINIYI 365


tr_hit_id -
Definition No hits.
Align length -
Score (bit) -
E-value -
Report
BLASTX 2.2.19 [Nov-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.

Query= BP918777|Adiantum capillus-veneris mRNA, clone:
YMU001_000117_D03.
(303 letters)

Database: uniprot_trembl.fasta
7,341,751 sequences; 2,391,615,440 total letters

Searching..................................................done

***** No hits found ******