| BP918924 |
| Clone id |
YMU001_000119_B02 |
| Library |
YMU01 |
| Length |
128 |
| Definition |
Adiantum capillus-veneris mRNA. clone: YMU001_000119_B02. |
| Accession |
BP918924 |
| Tissue type |
prothallium |
| Developmental stage |
- |
| Contig ID |
CL2253Contig1 |
| Sequence |
GCTTAATCCATGCAATCACCCCTGCAGTAAATGCGAATAGTGCAGCAAAGCCAAAAGCAG GCTCATTGCCACCTCCAAAAAGACCATCCCACGGACCAGCCCCTAACGCCACAATCATCT GAGGTACA |
| ■■Homology search results ■■ |
- |
| Swiss-Prot (release 56.9) |
Link to BlastX Result : Swiss-Prot |
| sp_hit_id |
O80605 |
| Definition |
sp|O80605|SUC3_ARATH Sucrose transport protein SUC3 OS=Arabidopsis thaliana |
| Align length |
23 |
| Score (bit) |
46.6 |
| E-value |
4.0e-05 |
| Report |
 |
| TrEMBL (release 39.9) |
Link to BlastX Result : TrEMBL |
| tr_hit_id |
Q58I04 |
| Definition |
tr|Q58I04|Q58I04_EUCUL Sucrose transporter 2 OS=Eucommia ulmoides |
| Align length |
42 |
| Score (bit) |
49.3 |
| E-value |
0.0001 |
| Report |
 |