BP918924 |
Clone id |
YMU001_000119_B02 |
Library |
YMU01 |
Length |
128 |
Definition |
Adiantum capillus-veneris mRNA. clone: YMU001_000119_B02. |
Accession |
BP918924 |
Tissue type |
prothallium |
Developmental stage |
- |
Contig ID |
CL2253Contig1 |
Sequence |
GCTTAATCCATGCAATCACCCCTGCAGTAAATGCGAATAGTGCAGCAAAGCCAAAAGCAG GCTCATTGCCACCTCCAAAAAGACCATCCCACGGACCAGCCCCTAACGCCACAATCATCT GAGGTACA |
■■Homology search results ■■ |
- |
Swiss-Prot (release 56.9) |
Link to BlastX Result : Swiss-Prot |
sp_hit_id |
O80605 |
Definition |
sp|O80605|SUC3_ARATH Sucrose transport protein SUC3 OS=Arabidopsis thaliana |
Align length |
23 |
Score (bit) |
46.6 |
E-value |
4.0e-05 |
Report |
|
TrEMBL (release 39.9) |
Link to BlastX Result : TrEMBL |
tr_hit_id |
Q58I04 |
Definition |
tr|Q58I04|Q58I04_EUCUL Sucrose transporter 2 OS=Eucommia ulmoides |
Align length |
42 |
Score (bit) |
49.3 |
E-value |
0.0001 |
Report |
|