| BP918959 | |
| Clone id | YMU001_000119_E05 |
| Library | YMU01 |
| Length | 515 |
| Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000119_E05. |
| Accession | BP918959 |
| Tissue type | prothallium |
| Developmental stage | - |
| Contig ID | CL1288Contig1 |
| Sequence | TGTCATTTATTTTTACAGATCTAAGATGCAGAGCTTTTTGTTATTTCCCCAAACACATTG |
| ■■Homology search results ■■ | - |
| Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
| sp_hit_id | Q6DCP6 |
| Definition | sp|Q6DCP6|DYM_XENLA Dymeclin OS=Xenopus laevis |
| Align length | 58 |
| Score (bit) | 30.0 |
| E-value | 6.3 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
| TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
| tr_hit_id | A8RWR2 |
| Definition | tr|A8RWR2|A8RWR2_9CLOT Putative uncharacterized protein OS=Clostridium bolteae ATCC BAA-613 |
| Align length | 58 |
| Score (bit) | 36.2 |
| E-value | 0.88 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |