BP918991
Clone id YMU001_000119_H03
Library
Length 456
Definition Adiantum capillus-veneris mRNA. clone: YMU001_000119_H03.
Accession
Tissue type prothallium
Developmental stage -
Contig ID -
Sequence
GAAAAACAACTTATCCAGGAGAGACAAGTCCAATTACTGGCTCTCGACTAAGTCTCCACA
CCATAGCCATATTTTTGTCATAGATAAATAATCACTTCCCTGAGTATTGGGTAGTGCCAA
TAACTACCCCATACACACTCCAGCTCAACTCTTGTCAGCATATATGCCAAAAATAACTCC
TGATTTATCTCATTTCTTCTCAACTTGGCTAATACTCCTGATTTGTCAACTAGCCTTTCA
GCAAAGGACGACGACTCCTCTTGATCCTACAGTGCTTCCCTTGATCCTCATTACAGCTAC
ACAAGTTCCTCATTACATTCGTTGGGGTATGCAATGTCGCAGTGCACAGCTGAAGCTACT
CCAGGTGTTGGCTCCAAGACTCCACTAGAAAAAGAATGGCTAGACCTAAACACATTGCGC
GCTTCCCTCTGCAATGGGTTAAGTGTATCTTTCACT
■■Homology search results ■■ -
sp_hit_id Q9P7T4
Definition sp|Q9P7T4|MRC1_SCHPO Mediator of replication checkpoint protein 1 OS=Schizosaccharomyces pombe
Align length 25
Score (bit) 29.3
E-value 8.4
Report
BLASTX 2.2.19 [Nov-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.

Query= BP918991|Adiantum capillus-veneris mRNA, clone:
YMU001_000119_H03.
(456 letters)

Database: uniprot_sprot.fasta
412,525 sequences; 148,809,765 total letters

Searching..................................................done



Score E
Sequences producing significant alignments: (bits) Value

sp|Q9P7T4|MRC1_SCHPO Mediator of replication checkpoint protein ... 29 8.4

>sp|Q9P7T4|MRC1_SCHPO Mediator of replication checkpoint protein 1
OS=Schizosaccharomyces pombe GN=mrc1 PE=1 SV=1
Length = 1019

Score = 29.3 bits (64), Expect = 8.4
Identities = 12/25 (48%), Positives = 19/25 (76%)
Frame = -2

Query: 248 SFAERLVDKSGVLAKLRRNEINQEL 174
SF LV ++ V+AKL+RN++ +EL
Sbjct: 409 SFNRNLVKRAAVMAKLQRNQLEEEL 433


tr_hit_id -
Definition No hits.
Align length -
Score (bit) -
E-value -
Report
BLASTX 2.2.19 [Nov-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.

Query= BP918991|Adiantum capillus-veneris mRNA, clone:
YMU001_000119_H03.
(456 letters)

Database: uniprot_trembl.fasta
7,341,751 sequences; 2,391,615,440 total letters

Searching..................................................done

***** No hits found ******