BP919039 | |
Clone id | YMU001_000120_D11 |
Library | YMU01 |
Length | 356 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000120_D11. |
Accession | BP919039 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | - |
Sequence | CCAAATGACGCAACAGTAGACTCCAAATGTGATGGAACTCGACTAACTCACGGAACCACT |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | - |
Definition | No hits. |
Align length | - |
Score (bit) | - |
E-value | - |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | B3NLB8 |
Definition | tr|B3NLB8|B3NLB8_DROER GG21697 OS=Drosophila erecta |
Align length | 73 |
Score (bit) | 34.3 |
E-value | 3.2 |
Report | BLASTX 2.2.19 [Nov-02-2008] |