BP919139 |
Clone id |
YMU001_000121_F09 |
Library |
YMU01 |
Length |
178 |
Definition |
Adiantum capillus-veneris mRNA. clone: YMU001_000121_F09. |
Accession |
BP919139 |
Tissue type |
prothallium |
Developmental stage |
- |
Contig ID |
- |
Sequence |
ACTTCACTTGCTGCTCCTACGCCACCATCCATAGCTATACCTACATTTGATTGTGCTAAT GCAGCTGCATCATTGACCCCATCACCAACCATAGCTACTTTCCTGCCTTTCTCTGACAAG CGCTTTACTAACTCAGCCTTTCCATGAGGCTTTACTCCACCATAGACCTCCTTTTTAT |
■■Homology search results ■■ |
- |
Swiss-Prot (release 56.9) |
Link to BlastX Result : Swiss-Prot |
sp_hit_id |
Q8XD24 |
Definition |
sp|Q8XD24|COPA_ECO57 Copper-exporting P-type ATPase A OS=Escherichia coli O157:H7 |
Align length |
56 |
Score (bit) |
74.3 |
E-value |
2.0e-13 |
Report |
|
TrEMBL (release 39.9) |
Link to BlastX Result : TrEMBL |
tr_hit_id |
A9SUQ2 |
Definition |
tr|A9SUQ2|A9SUQ2_PHYPA Predicted protein OS=Physcomitrella patens subsp. patens |
Align length |
58 |
Score (bit) |
84.0 |
E-value |
3.0e-15 |
Report |
|