BP919398 | |
Clone id | YMU001_000124_F08 |
Library | YMU01 |
Length | 161 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000124_F08. |
Accession | BP919398 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | CL10Contig1 |
Sequence | ATATTACCTGCAGGTACTCGGTAGCGAAATCCTTGTCGGGTAAGTTCCGACCCGCACGAA |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | Q3BAI2 |
Definition | sp|Q3BAI2|YCX91_PHAAO Uncharacterized protein ORF91 OS=Phalaenopsis aphrodite subsp. formosana |
Align length | 36 |
Score (bit) | 57.8 |
E-value | 2.0e-08 |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | A4QMC2 |
Definition | tr|A4QMC2|A4QMC2_PINKO ORF82c OS=Pinus koraiensis |
Align length | 36 |
Score (bit) | 57.8 |
E-value | 3.0e-07 |
Report | BLASTX 2.2.19 [Nov-02-2008] |