| BP919691 | |
| Clone id | YMU001_000128_A09 |
| Library | YMU01 |
| Length | 491 |
| Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000128_A09. |
| Accession | BP919691 |
| Tissue type | prothallium |
| Developmental stage | - |
| Contig ID | CL1889Contig1 |
| Sequence | GTGACTACAATTTTAACTGCATTTGACCAATTATCGATTGCTCAAACAACTATGACCTAT |
| ■■Homology search results ■■ | - |
| Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
| sp_hit_id | Q5ACW8 |
| Definition | sp|Q5ACW8|HIR1_CANAL Protein HIR1 OS=Candida albicans |
| Align length | 25 |
| Score (bit) | 29.6 |
| E-value | 7.8 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |
| TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
| tr_hit_id | Q0CHU5 |
| Definition | tr|Q0CHU5|Q0CHU5_ASPTN Putative uncharacterized protein OS=Aspergillus terreus (strain NIH 2624) |
| Align length | 107 |
| Score (bit) | 37.7 |
| E-value | 0.29 |
| Report | ![]() BLASTX 2.2.19 [Nov-02-2008] |