BP919691 | |
Clone id | YMU001_000128_A09 |
Library | YMU01 |
Length | 491 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000128_A09. |
Accession | BP919691 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | CL1889Contig1 |
Sequence | GTGACTACAATTTTAACTGCATTTGACCAATTATCGATTGCTCAAACAACTATGACCTAT |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | Q5ACW8 |
Definition | sp|Q5ACW8|HIR1_CANAL Protein HIR1 OS=Candida albicans |
Align length | 25 |
Score (bit) | 29.6 |
E-value | 7.8 |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | Q0CHU5 |
Definition | tr|Q0CHU5|Q0CHU5_ASPTN Putative uncharacterized protein OS=Aspergillus terreus (strain NIH 2624) |
Align length | 107 |
Score (bit) | 37.7 |
E-value | 0.29 |
Report | BLASTX 2.2.19 [Nov-02-2008] |