BP919949 | |
Clone id | YMU001_000131_B01 |
Library | YMU01 |
Length | 318 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000131_B01. |
Accession | BP919949 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | CL2311Contig1 |
Sequence | CTGGAAGAATTCGCGGCCGCGAATTGAAAGATTTGATGCATGATCGTTATCATCTTGCCA |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | A6QR00 |
Definition | sp|A6QR00|ZN526_BOVIN Zinc finger protein 526 OS=Bos taurus |
Align length | 35 |
Score (bit) | 30.0 |
E-value | 3.7 |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | - |
Definition | No hits. |
Align length | - |
Score (bit) | - |
E-value | - |
Report | BLASTX 2.2.19 [Nov-02-2008] |