BP920029
Clone id YMU001_000132_C03
Library
Length 514
Definition Adiantum capillus-veneris mRNA. clone: YMU001_000132_C03.
Accession
Tissue type prothallium
Developmental stage -
Contig ID
Sequence
AATAGTGGATCTTTTCATAACATTCACCAGCCTTTTCTCCTTCGAAACTGTTATTACCAA
TTTATGAGGAGAACCTGCATGGCCGAATTCTCCTATATGATACATCAACCCTGTCAATAC
CTATCACTTTGTCGACGAATATGCCTAAACATACCCAAATGTGCCTTCAAAGAGCACTCC
ATATCAAGGAGCAATTCTGCCCTTCACAGCACTTTTAGGAGAGATAACGTTGGCTTGAAA
CAGGCAAGCCAGCATAAACAATGTCCCTCATGAATAAGTCCTAAAAATTATTTTTGAAAC
CAAGCCCCTACAAATCAAAATCAGCTCTGAGACTTACCTCGTGTCGGTTGCTGACAGCTA
GAAGGGCTCCGTCAATGTGAAGTAGCCCACTTTTCAACCAACTCTTAATGAGTAGTCAAG
CTCTTCAAAATCATTAATCAATCCTGCCAATGCTAGCTGTGTAAAAGATAAGAAGAGCAC
TTGCGGGACAATAGGGGCTGCAAACTGATCAGCA
■■Homology search results ■■ -
sp_hit_id Q8SQ07
Definition sp|Q8SQ07|RNAS1_SAGOE Ribonuclease pancreatic OS=Saguinus oedipus
Align length 26
Score (bit) 30.8
E-value 3.8
Report
BLASTX 2.2.19 [Nov-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.

Query= BP920029|Adiantum capillus-veneris mRNA, clone:
YMU001_000132_C03.
(514 letters)

Database: uniprot_sprot.fasta
412,525 sequences; 148,809,765 total letters

Searching..................................................done



Score E
Sequences producing significant alignments: (bits) Value

sp|Q8SQ07|RNAS1_SAGOE Ribonuclease pancreatic OS=Saguinus oedipu... 31 3.8
sp|Q9WUV5|RNAS1_PERLE Ribonuclease pancreatic OS=Peromyscus leuc... 30 8.5

>sp|Q8SQ07|RNAS1_SAGOE Ribonuclease pancreatic OS=Saguinus oedipus
GN=RNASE1 PE=3 SV=1
Length = 156

Score = 30.8 bits (68), Expect = 3.8
Identities = 12/26 (46%), Positives = 18/26 (69%)
Frame = +3

Query: 297 KPSPYKSKSALRLTSCRLLTARRAPS 374
+P+ YKS S++R+T CRL R P+
Sbjct: 97 QPNCYKSSSSMRITDCRLTNGSRYPN 122


>sp|Q9WUV5|RNAS1_PERLE Ribonuclease pancreatic OS=Peromyscus
leucopus GN=RNASE1 PE=2 SV=1
Length = 148

Score = 29.6 bits (65), Expect = 8.5
Identities = 12/22 (54%), Positives = 17/22 (77%)
Frame = +3

Query: 309 YKSKSALRLTSCRLLTARRAPS 374
YKS+SALR+T CRL + + P+
Sbjct: 97 YKSRSALRITDCRLTGSSKYPN 118


tr_hit_id -
Definition No hits.
Align length -
Score (bit) -
E-value -
Report
BLASTX 2.2.19 [Nov-02-2008]


Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs", Nucleic Acids Res. 25:3389-3402.

Query= BP920029|Adiantum capillus-veneris mRNA, clone:
YMU001_000132_C03.
(514 letters)

Database: uniprot_trembl.fasta
7,341,751 sequences; 2,391,615,440 total letters

Searching..................................................done

***** No hits found ******