BP920258 | |
Clone id | YMU001_000134_H06 |
Library | YMU01 |
Length | 468 |
Definition | Adiantum capillus-veneris mRNA. clone: YMU001_000134_H06. |
Accession | BP920258 |
Tissue type | prothallium |
Developmental stage | - |
Contig ID | CL2386Contig1 |
Sequence | CAAATAATCAACACTTCGTAAGATGAGCTGAACATGGCACAATACCAAAAGGGCTTGCAT |
■■Homology search results ■■ | - |
Swiss-Prot (release 56.9) | Link to BlastX Result : Swiss-Prot |
sp_hit_id | Q8PMI8 |
Definition | sp|Q8PMI8|TPMT_XANAC Thiopurine S-methyltransferase OS=Xanthomonas axonopodis pv. citri |
Align length | 28 |
Score (bit) | 30.8 |
E-value | 3.1 |
Report | BLASTX 2.2.19 [Nov-02-2008] |
TrEMBL (release 39.9) | Link to BlastX Result : TrEMBL |
tr_hit_id | A7PYU8 |
Definition | tr|A7PYU8|A7PYU8_VITVI Chromosome chr12 scaffold_38, whole genome shotgun sequence OS=Vitis vinifera |
Align length | 68 |
Score (bit) | 81.3 |
E-value | 2.0e-14 |
Report | BLASTX 2.2.19 [Nov-02-2008] |